An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT033672.1

General info


NONCODE TRANSCRIPT IDNONHSAT033672.1
NONCODE Gene IDNONHSAG013454.1
Chromosomechr13
Start Site47466517
End Site47466733
Strand-
Exon Number1
CNCI Score-0.1552091
Length216
Assemblyhg19
Other transcript VersionsNONHSAT033672.2

Sequence


>NONHSAT033672.1
CCTCATAGGGTACCGGTGGCCTCTGCCGAGCAAGCTTTGTGCAGTCTGGATTTACCTGGACGTGCTCTTCTCCACGGCCTCCATCATGCACCTCTGCGCCATCTCGCTGGACCGCTACGTCGCCATCCAGAATCCCATCCACCACAGCCGCTTCAACTCCAGAACTAAGGCATTTCTGAAAATCATTGCTGTTTGGACCATATCAGTAGGTAAGTG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT033672
noncodeV3n337588
lncipedialnc-ESD-2-1