An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT033672.2

General info


NONCODE TRANSCRIPT IDNONHSAT033672.2
NONCODE Gene IDNONHSAG013454.2
Chromosomechr13
Start Site46892382
End Site46892598
Strand-
Exon Number1
CNCI Score-0.0536576
Length216
Assemblyhg38
Other transcript VersionsNONHSAT033672.1(old version)

Sequence


>NONHSAT033672.2
CCTCATAGGGTACCGGTGGCCTCTGCCGAGCAAGCTTTGTGCAGTCTGGATTTACCTGGACGTGCTCTTCTCCACGGCCTCCATCATGCACCTCTGCGCCATCTCGCTGGACCGCTACGTCGCCATCCAGAATCCCATCCACCACAGCCGCTTCAACTCCAGAACTAAGGCATTTCTGAAAATCATTGCTGTTTGGACCATATCAGTAGGTAAGTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
9.66401034.668110.844203.183900
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000002.56608
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00007.371671.977683.890040
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00003.98835
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
3.327230011.8940
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT033672
noncodeV3n337588
lncipedialnc-ESD-2-1