An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT033796.1

General info


NONCODE TRANSCRIPT IDNONHSAT033796.1
NONCODE Gene IDNONHSAG013515.1
Chromosomechr13
Start Site50618522
End Site50656128
Strand-
Exon Number4
CNCI Score-0.2841770
Length699
Assemblyhg19
Other transcript VersionsNONHSAT033796.2

Sequence


>NONHSAT033796.1
CGCCATTTTCGAGTGATGCCTGATCTCATCAATCTAGCGGGAGAGACAGGATAACCTGTCCGAGAGTATAGCGCCACTATGACTCCGCCGGAAAAATTACTTTAAAAATCGCCAAAAATTACTTGGAGCAAAGGGCAGTCGGCGGAGCTTCGCCAAGGCTGGCGCAGTCGGGTTTAATAATGATAGAATGAAGACCACAATAAAAGAGACCTCTACTTAGCTCAGCAATTCTTACCTTTCTTACCTATTTGATGAAGATGTCTTTTGAAAGGTGTACTGCAAGGAACAAAATGTTTGTAAATTCTCCTTTTACCAAGGTGGATAATTACTGTACCTTCCTCATGGAAAAAGTTTTATTTAAAGTGTTATTTCTCATTGAATACTATCAAAAAGGAAAAAAAAATGACCTAAACTTTTGAGATAGATTTGGCTCTAGTAAGTATTTAGTTATATCACTTGCATATCTGGGAGAAGAAATAAGAGACTATCATCAGTACATTCCCATCTACTAAAAAAATTTATTTTACACATGTCAAGGGATTACTTATAACTTCCATTTTATTACTAATAGCTTGAACCCTTTTAATGAAGACCTAACTCCTCCACCAGAAATTTAAGTTTATGTTCTTACTTTGTTTACTTATAAAATACATCTCAGGTATTTCGGATGTCTTTTTTTTTTCTAAGCCTATATGAAAT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT033771.1
NONHSAT033774.1
NONHSAT033777.1
NONHSAT033780.1
NONHSAT033781.1
NONHSAT033783.1
NONHSAT033784.1
NONHSAT033787.1
NONHSAT033788.1
NONHSAT033789.1
NONHSAT033790.1
NONHSAT033791.1
NONHSAT033792.1
NONHSAT033793.1
NONHSAT033794.1
NONHSAT033795.1
NONHSAT033797.1
NONHSAT033798.1
NONHSAT033800.1
NONHSAT033804.1
NONHSAT033805.1
NONHSAT140129.1
NONHSAT166765.1
NONHSAT166766.1
NONHSAT166767.1
NONHSAT166768.1

Data Sources

Source NameOld Id
lncipedialnc-SPRYD7-1-2_dup1
PMID26117828TCONS_00010278
PMID26117828PNCT_HSA167727
noncodeV3n378413
NONCODEv4NONHSAT033796