An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT033804.1

General info


NONCODE TRANSCRIPT IDNONHSAT033804.1
NONCODE Gene IDNONHSAG013515.1
Chromosomechr13
Start Site50623324
End Site50656109
Strand-
Exon Number3
CNCI Score-0.3454115
Length692
Assemblyhg19
Other transcript VersionsNONHSAT033804.2

Sequence


>NONHSAT033804.1
GCCATTTTCGAGTGATGCCTGATCTCATCAATCTAGCGGGAGAGACAGGATAACCTGTCCGAGAGTATAGCGCCACTATGACTCCGCCGGAAAAATTACTTTAAAAATCGCCAAAAATTACTTGGAGCAAAGGGCAGTCGGCGGAGCTTCGCCAAGGCTGGCGCAGTCGGTTTAATAATGATAGAATGAAGACCACAATAAAAGAGACCTCTACTTAGCTCAGCAATTCTTACCTTTCTTACCTATTTGATGAAGATGTCTTTTGAAAGGTGTACTGCAAGGAACAAAATGTTTGTAAATTCTCCTTTTACCAAGGTAAAGATCAAATTTTATAAATTTACTTGTTTGTTTATACAAGGAAAAATAACTTCATATATTGAATATATTCAAAAGTTTAAGCATTTAGTTGTATTGCCCTGTTAAGTTGGCATAGCAAATAAATGCTTTTCTTTTCCTCATTTTATTCTTTGTGTTTCCTAACCTATAGCACTGTGCTGGGCACAGAATGGACTTCAGTTAAGTTTTTGATGTAGAAATGTTTTATTATTCTACTTAAAATCTCCTTAAAAATAATTATGCATATTACATCAATGTTATAATGTTTAAACATAGATTTTTTTACATGCATTCTTTTTTTCCTGAAAGAAAATATTTTTTATATTCTTTAGGCGCGAATGTGTGTTTAAAAAAAATAAAACCTTGGAGTAAAG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT033771.1
NONHSAT033774.1
NONHSAT033777.1
NONHSAT033780.1
NONHSAT033781.1
NONHSAT033783.1
NONHSAT033784.1
NONHSAT033787.1
NONHSAT033788.1
NONHSAT033789.1
NONHSAT033790.1
NONHSAT033791.1
NONHSAT033792.1
NONHSAT033793.1
NONHSAT033794.1
NONHSAT033795.1
NONHSAT033796.1
NONHSAT033797.1
NONHSAT033798.1
NONHSAT033800.1
NONHSAT033805.1
NONHSAT140129.1
NONHSAT166765.1
NONHSAT166766.1
NONHSAT166767.1
NONHSAT166768.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00010280
noncodeV3n378094
ensemblENST00000421758
PMID26117828PNCT_HSA167743
gencodeENST00000421758.4
lncipedialnc-SPRYD7-1-8_dup1
NONCODEv4NONHSAT033804