An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT035540.1

General info


NONCODE TRANSCRIPT IDNONHSAT035540.1
NONCODE Gene IDNONHSAG014349.2
Chromosomechr14
Start Site19677643
End Site19679016
Strand-
Exon Number2
CNCI Score-0.1146880
Length563
Assemblyhg38
Other transcript VersionsNONHSAT035540.1(old version)

Sequence


>NONHSAT035540.1
ACCAATGCCTGGCTACAGGATCCCCTGAAACTGGAACAAGCCCTTCTTTGACTTCAACCTGCTTTTCAGAAACCAGGGGAGATATGGCGGGAGGGGAATACTTAGTTTCCACATAGGCCACCGGCCAGGAGGAAGAGGGCTTAGAATCGTGAAAGAGACTGGCCCAGGACCTGGGCTGGCTGACAGGAAGGGTGCCTGATGCAGAGCCCGTGCCGTCAGCAGGAGGTAGTTTATCCCCAGCTTGTGTGCCACACAGAACTGTTCCACTGCATGGAGGAAGCTCAACTGAAGATCGAGGAGTCACAAAGAACTGATTGAATTCATCAGGGCTAAAATCTCCAAAAATATACTGCGGGCTGTGGAGGGCCATGGCTGCCGGTTTCAATGGGACTCGGCGCTCCTCCGGCTGCTCACGCTGCCTCCCCCGCCGCCGCCATCTTCTCCCCCGCACATACACCCATCTATGACTATTTCAATAACTCCTATAACAGATGGAATTTTTGCAAGTTTTAGAATAACAAATAACATTAAAAATCGTTATGAATAAACATTAATTTACCTAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT035540
PMID26117828TCONS_00010709
PMID26117828PNCT_HSA031297
gencodeENST00000555580.1
lncipedialnc-POTEM-4-1_dup1
ensemblENST00000555580