An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT037918.1

General info


NONCODE TRANSCRIPT IDNONHSAT037918.1
NONCODE Gene IDNONHSAG015522.1
Chromosomechr14
Start Site77156481
End Site77157085
Strand-
Exon Number1
CNCI Score-0.2902931
Length604
Assemblyhg19
Other transcript VersionsNONHSAT037918.2

Sequence


>NONHSAT037918.1
TGGCTCCCCCGGACAGCCCCCAGGATAGCTAATGAGGCCAGGGGAAAGGGCCCCAACAAACCAGGTGAGGCAAAGAAGGACCCTCCCAACTCGGGCAAGGTGAAAAAAGCAGCCAAGAGGCCAGCAGAGCTGCCGACGTCTCCCAAATTAGATGCAGCCAAGGAGAAGCCCCCACCCCCCCCAGCAGGGCAGTGAGGCTGAGGACACAAAGGCAAAGCCATGTAGGCCTCTTCCTGTGCCAGTGGGCTCAGCAAGAAGCCAAAGGCCAAAGGCAGCAGGAGCAGCTAAGGAGACGCTGAGGCTCACAGGAATATCAAAGCTGGGAGTAAGAGTTCAAAACCCACGGCTAGCAAGGTCAAGAACGGTGCTGCTTCCCCCACCAAAAAGAAGGTGGTGGCCAAGGCCAAGGCCCCTAAAAGGGCAGCTGCCCAGGGTGCTGGGCAGGAGCCAAACACCAAGGCAGCTTCTCCTGCTAGGGGCAGTGGGTCCAAGGTGGTGCCTGCACACCTGACCGGGAAGACAGAGGCCTCCAAGGGCCTGAGAAAGCCTGGGTTGTCCATCAAGGCCTCATCATCCAAAGTGTTCAATCAGAGGGCTGAGGCCT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000557720
NONCODEv4NONHSAT037918
lncipedialnc-ANGEL1-6-1_dup1