An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT039193.1

General info


NONCODE TRANSCRIPT IDNONHSAT039193.1
NONCODE Gene IDNONHSAG015679.1
Chromosomechr14
Start Site90095264
End Site90109015
Strand-
Exon Number2
CNCI Score-0.0260351
Length420
Assemblyhg19
Other transcript VersionsNONHSAT039193.2

Sequence


>NONHSAT039193.1
AGAGAATTTGCTGAACGAAGGAAGATGCAGGAAGAGAGGCCTTGGTCTTGAGTGGGGCAATCAGCAAGCTGAAGACTTCTTCTACTCATCTATTGACATTCATTGGTGTGGCATCGGCTCCTGCAAAGACCTCATAAACTGGTTTTAGGCCAACAGGAGACAAAGTTCCCCGTACTAAAAGGGTACAACCCTTGGTTTTCACAGGGATCAGTTCTTTGCTCTTTGAAACGAGATGATCCATCTCACACTGAAAGTTTCCTATCGTGAGGTTCAGTGTCATCTAGAGTCAACGGATGAAGTATAAGTGTTCACTGTGGAATTTCTACAACACAAAAAGAAGAGGCTGGATAAAGAAGATAAACTGAATATTGAAACTGTTCCTTTTCCATTAAAAAATAGCAAAAAAAGTTTTCCCTGTAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT039195.1

Data Sources

Source NameOld Id
lncipedialnc-RP11-944C7.1.1-2-1_du
ensemblENST00000553996
NONCODEv4NONHSAT039193
PMID26117828PNCT_HSA034591
gencodeENST00000553996.2