An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT039195.1

General info


NONCODE TRANSCRIPT IDNONHSAT039195.1
NONCODE Gene IDNONHSAG015679.1
Chromosomechr14
Start Site90095284
End Site90100426
Strand-
Exon Number3
CNCI Score-0.2521713
Length698
Assemblyhg19
Other transcript VersionsNONHSAT039195.2

Sequence


>NONHSAT039195.1
AAAACTAGTTTTGCTCAGAAGTCATAGTATGTTCCTTGACCCACAGATCTGGTAGCTGGATTCTTGCATTGCTTCCCTATTCTGCTAAATTACCTGGCAGTGCAGTTCCCGCTAAGAAAAGGTCCTCAAACTCAGCCCAGGGGCTAGGAACCCTTTATCCACCAATGGACTAGCTTAATTCTATTTGACTGTATCTCTAGGTCCCAGTTGCTTTGCTCCATTTGTCCCTGAGCATGGACTAAGGCATTGATTTCCAGGCCCAATTAGGGCTCTGGTTCACTGTCTGGGATGCTGCTGAGCGGGTGGTCCAGGAAACACAACTGTGGGGTTTGCAACAAGCCCTGGCCCAGCGCACGTGGCATCACAGGGGAAGTTAGGTTTGCATCTAGAAAGAGATCTAGTCCGAGCGTGGAGAAGGCAGAACCAAACCCACATGGTTGAGACCCACATCTCAGTTCAGCAGTTCCAGAGATCCTGCAAGCCCTAGAGCCTTTGCAGGCAGGGATCAGTTCTTTGCTCTTTGAAACGAGATGATCCATCTCACACTGAAAGTTTCCTATCGTGAGGTTCAGTGTCATCTAGAGTCAACGGATGAAGTATAAGTGTTCACTGTGGAATTTCTACAACACAAAAAGAAGAGGCTGGATAAAGAAGATAAACTGAATATTGAAACTGTTCCTTTTCCATTAAAAAATAGC

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT039193.1

Data Sources


Source NameOld Id
NONCODEv4NONHSAT039195
ensemblENST00000555560
PMID26117828PNCT_HSA034593
lncipedialnc-RP11-944C7.1.1-2-2_du
gencodeENST00000555560.1