An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT040618.1

General info


NONCODE TRANSCRIPT IDNONHSAT040618.1
NONCODE Gene IDNONHSAG016199.1
Chromosomechr15
Start Site20554570
End Site20564419
Strand+
Exon Number2
CNCI Score-0.0662532
Length427
Assemblyhg19
Other transcript VersionsNONHSAT040618.2

Sequence


>NONHSAT040618.1
TGGGACAGCCCTCCCCCTCCCCCTGGGACTCCATGGCCTGTGCTGTCCTCCTGCCCAAGAAGCTTCCCTCTGAGGCATCTCGGGTCCGGGTCCGTCCTGCTCACCCAGGGCCAGGAGCCCCCAGGAGGCCCACGGTGCACCCCCAGCCCAGGCGACATCAACGGCCAGCCCCATACGCGTGAGGATTGCGGCACCAGGGGCGCTCAGGATTGGGCCGGGCTGCTTCTCAGAAGAGGGGACATTGAGCCCAAGCAGGCTGCACTCCTGCTTGGACGGAAGGTGCATGGGTGGGGAGGGTAATCACACCAATAGAGACATGGATGGACTTGTGCAGAACATAAATACTCTCTTTGCTTATGTCTATGTTACTCAAAGGAACCATGGAAATAACAAATTCCCAATTACAATGCAGTAAACTTTAAGAGGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT040606.1

Data Sources

Source NameOld Id
lncipedialnc-OR4M2-6-2_dup1
ensemblENST00000554815
PMID26117828PNCT_HSA035847
PMID26117828TCONS_00011748
NONCODEv4NONHSAT040618
gencodeENST00000554815.1