An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT040618.2

General info


NONCODE TRANSCRIPT IDNONHSAT040618.2
NONCODE Gene IDNONHSAG016199.2
Chromosomechr15
Start Site20349317
End Site20359166
Strand+
Exon Number2
CNCI Score-0.0270336
Length427
Assemblyhg38
Other transcript VersionsNONHSAT040618.1(old version)

Sequence


>NONHSAT040618.2
TGGGACAGCCCTCCCCCTCCCCCTGGGACTCCATGGCCTGTGCTGTCCTCCTGCCCAAGAAGCTTCCCTCTGAGGCATCTCGGGTCCGGGTCCGTCCTGCTCACCCAGGGCCAGGAGCCCCCAGGAGGCCCACGGTGCACCCCCAGCCCAGGCGACATCAACGGCCAGCCCCATACGCGTGAGGATTGCGGCACCAGGGGCGCTCAGGATTGGGCCGGGCTGCTTCTCAGAAGAGGGGACATTGAGCCCAAGCAGGCTGCACTCCTGCTTGGACGGAAGGTGCATGGGTGGGGAGGGTAATCACACCAATAGAGACATGGATGGACTTGTGCAGAACATAAATACTCTCTTTGCTTATGTCTATGTTACTCAAAGGAACCATGGAAATAACAAATTCCCAATTACAATGCAGTAAACTTTAAGAGGA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0000.1874490000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000.09117210.54192700
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
37.7522045.5801030.7926
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
45.25490055.56220
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset