An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT041271.1

General info


NONCODE TRANSCRIPT IDNONHSAT041271.1
NONCODE Gene IDNONHSAG016373.1
Chromosomechr15
Start Site29034809
End Site29035450
Strand+
Exon Number2
CNCI Score-0.1048400
Length498
Assemblyhg19
Other transcript VersionsNONHSAT041271.2

Sequence


>NONHSAT041271.1
CCAACAGAGAGGTTCCTGTTTGGACCCAGGAGAGTGGAAGAGAGATTGGGACTGAGTGCTGAGATTGGGAAGGCACCTGCTCCCACAGAAGGGGGAACGCAAGGGGCGTCCCAAGACCTCATCTGCCTGCAGCGTCACACCGATGGCCTGGCCTCGGCTTCTCATTATTTGCAACTGCCATGGATGTTTACAGGAACCCAGCCAGAGTTTGCCTCCCTGCACTTCATCCCAGAGCGCACCTGCTTCCTCCACTTCACCTTCGGAGAGGACACTTCAAACTGCGGACACACGCAAAAGCAACTCCCAGCTCTGTTTGATGTTACTCGTTCCTCAGCAAGTTGGCAAAACAGATATCATGCTGGTGAGTGCCACGTTACTCCCCTGGCTGCAAATGCTTTTCTGAAAGTATGAGTGTCGTGCCTACTTAATTCTGATAAACCTGTTTAAGCAATACTTAGGAGGCTGACTTCTTTGGATTAAAAAAATGTATGCAACTCC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT140220.1

Data Sources

Source NameOld Id
NONCODEv4NONHSAT041271
ensemblENST00000565892
lncipedialnc-APBA2-5-1
PMID26117828PNCT_HSA036345