An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT047646.2

General info


NONCODE TRANSCRIPT IDNONHSAT047646.2
NONCODE Gene IDNONHSAG017590.2
Chromosomechr15
Start Site79219961
End Site79220784
Strand+
Exon Number2
CNCI Score-0.0778240
Length324
Assemblyhg38
Other transcript VersionsNONHSAT047646.1(old version)

Sequence


>NONHSAT047646.2
GAGTCTGGCAGCTGGATTGGGGTGAAGGGCAGGGGCATGGTTTGCTCTTACTGCCCCCTCCTCTCCCCATCCTGGCACTCTTTCTCTGGAGTAGATGCAGGAGGAGAGAGAGGAGGACAGGTTTTCTTCACATCCTGATTGCAGTTGATTCTTTCCTGGCCAGCACTGCCAAGCCACCAGCTACAGCCAGTTGACATTTCAGAGCGACAAGAAAACTCCAACCAGGCACCCTATTACACTGGAACATCCTTTTGTAAAGGGGTCCTCAGGGGCCATTTATGAAGAAGCCAGGACATCATCCCAGGCCTCCCGAGTCAAGGCACG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000.253441001.57186
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.4314820000000
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000026.5154
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
33.8230019.8280
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-ANKRD34C-1-1_dup1
noncodeV3Human
PMID26117828TCONS_00013071
PMID26117828PNCT_HSA188192
NONCODEv4NONHSAT047646
noncodeV3n374655