An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT052013.1

General info


NONCODE TRANSCRIPT IDNONHSAT052013.1
NONCODE Gene IDNONHSAG018280.1
Chromosomechr16
Start Site1838694
End Site1839187
Strand-
Exon Number2
CNCI Score-0.2533638
Length415
Assemblyhg19
Other transcript VersionsNONHSAT052013.2

Sequence


>NONHSAT052013.1
TCTGTCGCCACAGCAGCGGACACGTTTAATGGCAGGCGCCTCTACAGTTACAAAACATGCCTGAGGTCAGTTCGCCCCCTTAGGGGGCACTCCCCGAGCTAAACACAGATGACAGCGACCCAGGGTGCTGGAGGCCCGGGGTCACCTGAGGACTGCAGAAGTCCCGCGCTCCGCTAACTGTGTGGACACGCGGCTGCCAGGGGCACAGGCCAACCAGGCAGAGCTGCTGGTGCGACACATCCTGGGGCTGGGCTGGTCGGGGAGAAGCTCTCCGGCTGACGCTGCCTGGGCCTGCCCCTGCAGGGCCCGGGAACCGAGCCCAGGCCTCTGTTTCTCTGAGAGGCTGGAGCAGAGCCCTTGGTGGCCCTGGAAAGCGGCTGCAAGGTGGCCTTAGTCAGGGGAGGCACGCGGGCGT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT052013
PMID26117828TCONS_00013888
lncipedialnc-IGFALS-1-1_dup1
PMID26117828PNCT_HSA041176