An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT052651.1

General info


NONCODE TRANSCRIPT IDNONHSAT052651.1
NONCODE Gene IDNONHSAG021335.1
Chromosomechr17
Start Site27076748
End Site27077097
Strand-
Exon Number2
CNCI Score-0.0174412
Length287
Assemblyhg19
Other transcript VersionsNONHSAT052651.2

Sequence


>NONHSAT052651.1
TAATAAATACAATTCCGGATTTATTAAAAATCAGGGCTCCCCTGCTGTGCCCTCCTGGCACTAAGGAAATAAATAACCAGAGGGGGCACAGCTAGGTAAAGGGGGAAAAAATCAGATCTCAAGACAGACTCTTTGAACTACCCTTTCTCCCTCCCCAATTCCCACCCCCTTATGGCTCTTGGGACATAGCACCTGAGCAGGCACCTCAGTCCGTGTAGAGTGTGACCGGCACCAAGGCATGTCTGCCCTACCCAAGAAGGGAGACAGGGCTGAAGCACCAATTGGAG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
gencodeENST00000579468.1
ensemblENST00000579468
NONCODEv4NONHSAT052651
lncipedialnc-C17orf63-1-1_dup1
PMID26117828PNCT_HSA047765
PMID26117828TCONS_00015782