An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT052724.1

General info


NONCODE TRANSCRIPT IDNONHSAT052724.1
NONCODE Gene IDNONHSAG021372.2
Chromosomechr17
Start Site29621616
End Site29622254
Strand-
Exon Number1
CNCI Score-0.8970240
Length638
Assemblyhg38
Other transcript VersionsNONHSAT052724.1(old version)

Sequence


>NONHSAT052724.1
TTGAAGACCCCACCCCTAGAAGAGTTCACTAGGAAGAAGGCCCAACCAGGGCAGAGGACCCAGAGGAGAAACCGGACAAGCCTATGGTAGGCAAAAGCCAGAAGACCATGATCAGGGCTTCCTGGAGAAGCCAGTGCAGAAAGGAGTGGGAGAAGAGGGATCCACCTCACTCTGTGCTGCCACCCGTCCCCCCACAAGGCATGGGATGAAAACAGTAGCAGAAAGGACTCAGATTGGTGGACAGGAGGAACTTCCCCCTTGGCAAAATTTTAGGAAAAGGCAAAACCCCATCTGCCTGAACTATTCCAGAGATGCGAGTTCGGTATCCTGTGGTGGCTGCAGTCTTGGCCCCATACCTGGCTTTAAGCCAAGATCCAATGGTCAAGTCTTCTGCTTCTGGACAGGGTGCCTCTGGGAGCTACAACCACGTCCGTGAAGAGATGCTCATCAAGGCTGGCGGTGGTGGGGGCGGGGGGTGCAGGCAGTGTGGCATTGAGGCTCCTCCCAAAAACATTCCAACGTCCAGAAAGCTTTCAGTCTGTTAGGCTCCACAATCCCCTCAGCCTGGGTCTCTGTGGAGAATTCAGGCCCCAAATCCTAGCCACTTACATTAAACAGCATTTTACACAGCAAAATAA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000582367
PMID26117828TCONS_00015787
gencodeENST00000582367.1
lncipedialnc-SSH2-1-1_dup1
NONCODEv4NONHSAT052724