An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053085.2

General info


NONCODE TRANSCRIPT IDNONHSAT053085.2
NONCODE Gene IDNONHSAG021540.2
Chromosomechr17
Start Site35344230
End Site35344564
Strand+
Exon Number1
CNCI Score-0.0929792
Length334
Assemblyhg38
Other transcript VersionsNONHSAT053085.1(old version)

Sequence


>NONHSAT053085.2
TGCTAACGTGGAAGATGGCAAGGAGCCCTGTGCCTTGTCCTCTCACTCTGGGAGCACAGGCTGCAAGTTGGAAGGGCAACAAAAATGTTCTCTCTCCAGGTGTGAAACACAGTGGGCATGTAGAGCTGCGACACGGAGTGCCATACAACTGCCATCTGCAGGGTTGAGGTGATGGATGCCTTTCTTGGGTGTCAAGCTGAAAACAAGAGAACTGTGCTGTCATCTGAGGAGAATGTAATCACTCCTTCCACAACTGTTGCATGTCCCTGTGGGTACAACAGAGCAATCACTGACCTCTCTGCCAGCAAGACTGGATGGTCTAAAGAATAAGAGA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000000.641437
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00.8159120010.2457
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
8.74051005.766640
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000588235
lncipedialnc-SLFN5-2-1_dup1
NONCODEv4NONHSAT053085