An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053416.1

General info


NONCODE TRANSCRIPT IDNONHSAT053416.1
NONCODE Gene IDNONHSAG021691.2
Chromosomechr17
Start Site39173289
End Site39177503
Strand+
Exon Number2
CNCI Score-0.1187840
Length573
Assemblyhg38
Other transcript VersionsNONHSAT053416.1(old version)

Sequence


>NONHSAT053416.1
AGTCTGGGACTGGCAGAATCCCTGATTTTCTCTGACCTGCCCCCACAAGTAGTCTGCCTCCCTGTCCCCAAAGCTGGTTAGCAGGAACGAGGGGGGCATTAGTGGAGCCAGAAGCTCAGCCCCTCCCTCTCCTGAGGTGTTGGGGCACAGTGATGCCACAAGAGCAGAAAAACAGTCATGTGTATTTAAGACATTGCACCAGTGGGTCTGGATCTCACCCACTGAGCAACATTGAGCTTCCCATTGCCTTTGGCTCTACTTGTGGAGAGACAGTTCCGACCCCAGAGCAGGAGGGAAGACGGGCAGGGCGCCCACTACATGGCATGTTCCTGCTCCTGGGGCACCACACTGCCCCGCTGTGAGGACTCCAGCCCGCCCCAGAAGCCGAGGTTTCTCCTGAGCGAGGTGAGCACCTGTACCTGGAGGTTGGAGACAGGGGCAGGGCTGGCAGCCAGGGCTGCGGTAGCCATGGTGCGGTTCAGCAGCGGATTGGGTGGCGTGCTGCTGGGCGGGTGTGTGGCCTTCCAATAGGCTTCCAAGTACTCCGCCAGATGCTCGCAGGCATCCTCCAAT

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT053417.2
NONHSAT053418.2
NONHSAT053419.2

Data Sources


Source NameOld Id
ensemblENST00000579256
lncipedialnc-RPL19-1-1_dup1
gencodeENST00000579256.1
PMID26117828TCONS_00015439
NONCODEv4NONHSAT053416
PMID26117828PNCT_HSA048482