An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053417.1

General info


NONCODE TRANSCRIPT IDNONHSAT053417.1
NONCODE Gene IDNONHSAG021691.2
Chromosomechr17
Start Site39173827
End Site39184361
Strand+
Exon Number3
CNCI Score-0.0552960
Length1151
Assemblyhg38
Other transcript VersionsNONHSAT053417.1(old version)

Sequence


>NONHSAT053417.1
TGGCAAAATACTTCTCCTAGGGGAGTACAGACAAATATAGACAGACAGATGGGGGCACAGGACACCAGACAGGGAGGGGGGAAGGGAGGGCAGTGGTGTCTTCTAATCAGTAAGTGGAAGCTGCACCCCACCCCCAGGTGGAGGGTGGGACATTGGCACAGGAGGTGGCGAGACAGGCATGAGGTGCCCATCCCTGAGGCGGGCAGCCGGGCAGGCCCCAGTCCTTGTTGGCACACTCGGCTCTCTCTGGCCCAGCTGGGATGCTGGGGAGGGGCAGGGTTGCTGGGCTACAGGGATGCCAAGGCAAAGGGATGCCCCAGGGGAGAGGGGGTACCAAGGCCTCTCCTGGGGGAAGTGAACATGGGTAACAAACAGAATCACGAGAGGCAAATACAGAGCAGCAACAGCAGCAGCCAAGCCCCCCAGAGGAGATCCGAGGTCCCAAGGCAACCCCTGGGCACCATCCCACGGGTCCTCTCCCCTGGGGCCTCAGGGTGAGGGTGAAGGAGCAGTTTTTTGGTTTAAAATGAGGCGGACCAGAGTGTTCCATGGGCTCCACACCCAGGTGGCACAGGGATGGGGGGCTCAGATGCAGAGGGGCCCCCTCTACTAATGGCAGCAGGCAAGGGATGTTGGAGGCCAAGCTCATTCCTGGGGTAGGCAAAGGCTGAGGCATGGAGGTGGGGGGTGGGGAGCAGCGTCTCGGCCGCTCACTCCTCAGGGTTCTGGGCCCTGGACGTTGCCATGGCCACGGAGGGTAGAGGGTGCTGTATGCCTGCCAGCTTCCACCCAGAACCCTCCCCAAGACAAGCTCCCCATGGGGTGTCCATGCTATGGCTTTCACCGACCAGACGATGCTGCCAGGAAGCTGGGAGGAAGGGGCAGGCAGGTTCCGACCCCAGAGCAGGAGGGAAGACGGGCAGGGCGCCCACTACATGGCATGTTCCTGCTCCTGGGGCACCACACTGCCCCGCTGTGAGGACTCCAGCCCGCCCCAGAAGCCGAGGTTTCTCCTGAGCGAGTCCGAGTCCCAGGATTGTGATTCGAGGCATCCTGCCCATCCCCAGCAGCAGAGAGCAACGGCAGGTGCGAGGAGCAGCTCCCAGGATCTTACCTGCCATCAAACCGATGCTTCAAGAAGTCAAATAAAG

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT053416.2
NONHSAT053418.2
NONHSAT053419.2

Data Sources


Source NameOld Id
lncipedialnc-RPL19-1-2_dup1
PMID26117828PNCT_HSA048484
PMID26117828TCONS_00016161
NONCODEv4NONHSAT053417