An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053418.1

General info


NONCODE TRANSCRIPT IDNONHSAT053418.1
NONCODE Gene IDNONHSAG021691.2
Chromosomechr17
Start Site39173827
End Site39184361
Strand+
Exon Number3
CNCI Score-0.0671744
Length1556
Assemblyhg38
Other transcript VersionsNONHSAT053418.1(old version)

Sequence


>NONHSAT053418.1
TGGCAAAATACTTCTCCTAGGGGAGTACAGACAAATATAGACAGACAGATGGGGGCACAGGACACCAGACAGGGAGGGGGGAAGGGAGGGCAGTGGTGTCTTCTAATCAGTAAGTGGAAGCTGCACCCCACCCCCAGGTGGAGGGTGGGACATTGGCACAGGAGGTGGCGAGACAGGCATGAGGTGCCCATCCCTGAGGCGGGCAGCCGGGCAGGCCCCAGTCCTTGTTGGCACACTCGGCTCTCTCTGGCCCAGCTGGGATGCTGGGGAGGGGCAGGGTTGCTGGGCTACAGGGATGCCAAGGCAAAGGGATGCCCCAGGGGAGAGGGGGTACCAAGGCCTCTCCTGGGGGAAGTGAACATGGGTAACAAACAGAATCACGAGAGGCAAATACAGAGCAGCAACAGCAGCAGCCAAGCCCCCCAGAGGAGATCCGAGGTCCCAAGGCAACCCCTGGGCACCATCCCACGGGTCCTCTCCCCTGGGGCCTCAGGGTGAGGGTGAAGGAGCAGTTTTTTGGTTTAAAATGAGGCGGACCAGAGTGTTCCATGGGCTCCACACCCAGGTGGCACAGGGATGGGGGGCTCAGATGCAGAGGGGCCCCCTCTACTAATGGCAGCAGGCAAGGGATGTTGGAGGCCAAGCTCATTCCTGGGGTAGGCAAAGGCTGAGGCATGGAGGTGGGGGGTGGGGAGCAGCGTCTCGGCCGCTCACTCCTCAGGGTTCTGGGCCCTGGACGTTGCCATGGCCACGGAGGGTAGAGGGTGCTGTATGCCTGCCAGCTTCCACCCAGAACCCTCCCCAAGACAAGCTCCCCATGGGGTGTCCATGCTATGGCTTTCACCGACCAGACGATGCTGCCAGGAAGCTGGGAGGAAGGGGCAGGCAGGGTGAGGGACCTTGGATCTGGGGTCTGGGGAAGAGAGCCCCCATGGGAAAGAATCTGTGGCCTCCCTTTCCAGGAAAAGCGCCCAGCCCTTCCCCAGTACTGCAGCTTGGGAGAAGGAGAGCCATCCCACTTAGGACCGTCACTTAGGGCCCCGAGTAGAAAGAGTTAAGGAAGTGCACCTTTTCTCTAGGAGGGTGAGGGAGGAGAGCCCCTTAAGATGGGAGAAAGGGGACACTTCAGAAAGGTGGGTATCCCCCATCCATCCACAACAGGCAGGTAAAAACCGACAGCTGGGGCTTAAGGGCCTCCCGGGAGCTGGGATGGTAACACCAAAGAAACCCCAAGCTTTGAGCAAAGGCATCTGAAAGGAGGGAGACAGCGCCCCCTGGAGGCGAATACATGTCAGTTCCGACCCCAGAGCAGGAGGGAAGACGGGCAGGGCGCCCACTACATGGCATGTTCCTGCTCCTGGGGCACCACACTGCCCCGCTGTGAGGACTCCAGCCCGCCCCAGAAGCCGAGGTTTCTCCTGAGCGAGTCCGAGTCCCAGGATTGTGATTCGAGGCATCCTGCCCATCCCCAGCAGCAGAGAGCAACGGCAGGTGCGAGGAGCAGCTCCCAGGATCTTACCTGCCATCAAACCGATGCTTCAAGAAGTCAAATAAAG

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT053416.2
NONHSAT053417.2
NONHSAT053419.2

Data Sources


Source NameOld Id
NONCODEv4NONHSAT053418
PMID26117828PNCT_HSA048483
PMID26117828TCONS_00016160
lncipedialnc-RPL19-1-3_dup1