An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053418.1

General info


NONCODE TRANSCRIPT IDNONHSAT053418.1
NONCODE Gene IDNONHSAG021691.1
Chromosomechr17
Start Site37330080
End Site37340614
Strand+
Exon Number3
CNCI Score-0.1645837
Length1556
Assemblyhg19
Other transcript VersionsNONHSAT053418.2

Sequence


>NONHSAT053418.1
TGGCAAAATACTTCTCCTAGGGGAGTACAGACAAATATAGACAGACAGATGGGGGCACAGGACACCAGACAGGGAGGGGGGAAGGGAGGGCAGTGGTGTCTTCTAATCAGTAAGTGGAAGCTGCACCCCACCCCCAGGTGGAGGGTGGGACATTGGCACAGGAGGTGGCGAGACAGGCATGAGGTGCCCATCCCTGAGGCGGGCAGCCGGGCAGGCCCCAGTCCTTGTTGGCACACTCGGCTCTCTCTGGCCCAGCTGGGATGCTGGGGAGGGGCAGGGTTGCTGGGCTACAGGGATGCCAAGGCAAAGGGATGCCCCAGGGGAGAGGGGGTACCAAGGCCTCTCCTGGGGGAAGTGAACATGGGTAACAAACAGAATCACGAGAGGCAAATACAGAGCAGCAACAGCAGCAGCCAAGCCCCCCAGAGGAGATCCGAGGTCCCAAGGCAACCCCTGGGCACCATCCCACGGGTCCTCTCCCCTGGGGCCTCAGGGTGAGGGTGAAGGAGCAGTTTTTTGGTTTAAAATGAGGCGGACCAGAGTGTTCCATGGGCTCCACACCCAGGTGGCACAGGGATGGGGGGCTCAGATGCAGAGGGGCCCCCTCTACTAATGGCAGCAGGCAAGGGATGTTGGAGGCCAAGCTCATTCCTGGGGTAGGCAAAGGCTGAGGCATGGAGGTGGGGGGTGGGGAGCAGCGTCTCGGCCGCTCACTCCTCAGGGTTCTGGGCCCTGGACGTTGCCATGGCCACGGAGGGTAGAGGGTGCTGTATGCCTGCCAGCTTCCACCCAGAACCCTCCCCAAGACAAGCTCCCCATGGGGTGTCCATGCTATGGCTTTCACCGACCAGACGATGCTGCCAGGAAGCTGGGAGGAAGGGGCAGGCAGGGTGAGGGACCTTGGATCTGGGGTCTGGGGAAGAGAGCCCCCATGGGAAAGAATCTGTGGCCTCCCTTTCCAGGAAAAGCGCCCAGCCCTTCCCCAGTACTGCAGCTTGGGAGAAGGAGAGCCATCCCACTTAGGACCGTCACTTAGGGCCCCGAGTAGAAAGAGTTAAGGAAGTGCACCTTTTCTCTAGGAGGGTGAGGGAGGAGAGCCCCTTAAGATGGGAGAAAGGGGACACTTCAGAAAGGTGGGTATCCCCCATCCATCCACAACAGGCAGGTAAAAACCGACAGCTGGGGCTTAAGGGCCTCCCGGGAGCTGGGATGGTAACACCAAAGAAACCCCAAGCTTTGAGCAAAGGCATCTGAAAGGAGGGAGACAGCGCCCCCTGGAGGCGAATACATGTCAGTTCCGACCCCAGAGCAGGAGGGAAGACGGGCAGGGCGCCCACTACATGGCATGTTCCTGCTCCTGGGGCACCACACTGCCCCGCTGTGAGGACTCCAGCCCGCCCCAGAAGCCGAGGTTTCTCCTGAGCGAGTCCGAGTCCCAGGATTGTGATTCGAGGCATCCTGCCCATCCCCAGCAGCAGAGAGCAACGGCAGGTGCGAGGAGCAGCTCCCAGGATCTTACCTGCCATCAAACCGATGCTTCAAGAAGTCAAATAAAG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT053416.1
NONHSAT053417.1
NONHSAT053419.1

Data Sources

Source NameOld Id
NONCODEv4NONHSAT053418
PMID26117828PNCT_HSA048483
PMID26117828TCONS_00016160
lncipedialnc-RPL19-1-3_dup1