An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053419.1

General info


NONCODE TRANSCRIPT IDNONHSAT053419.1
NONCODE Gene IDNONHSAG021691.1
Chromosomechr17
Start Site37330631
End Site37333753
Strand+
Exon Number2
CNCI Score-0.2039256
Length636
Assemblyhg19
Other transcript VersionsNONHSAT053419.2

Sequence


>NONHSAT053419.1
GGCTCCACACCCAGGTGGCACAGGGATGGGGGGCTCAGATGCAGAGGGGCCCCCTCTACTAATGGCAGCAGGCAAGGGATGTTGGAGGCCAAGCTCATTCCTGGGGTAGGCAAAGGCTGAGGCATGGAGGTGGGGGGTGGGGAGCAGCGTCTCGGCCGCTCACTCCTCAGGGTTCTGGGCCCTGGACGTTGCCATGGCCACGGAGGGTAGAGGGTGCTGTATGCCTGCCAGCTTCCACCCAGAACCCTCCCCAAGACAAGCTCCCCATGGGGTGTCCATGCTATGGCTTTCACCGACCAGACGATGCTGCCAGGAAGCTGGGAGGAAGGGGCAGGCAGGTTCCGACCCCAGAGCAGGAGGGAAGACGGGCAGGGCGCCCACTACATGGCATGTTCCTGCTCCTGGGGCACCACACTGCCCCGCTGTGAGGACTCCAGCCCGCCCCAGAAGCCGAGGTTTCTCCTGAGCGAGGTGAGCACCTGTACCTGGAGGTTGGAGACAGGGGCAGGGCTGGCAGCCAGGGCTGCGGTAGCCATGGTGCGGTTCAGCAGCGGATTGGGTGGCGTGCTGCTGGGCGGGTGTGTGGCCTTCCAATAGGCTTCCAAGTACTCCGCCAGATGCTCGCAGGCATCCTCC

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT053416.1
NONHSAT053417.1
NONHSAT053418.1

Data Sources

Source NameOld Id
PMID26117828TCONS_00016162
PMID26117828PNCT_HSA048485
lncipedialnc-RPL19-1-4_dup1
NONCODEv4NONHSAT053419