An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT053514.1

General info


NONCODE TRANSCRIPT IDNONHSAT053514.1
NONCODE Gene IDNONHSAG021731.2
Chromosomechr17
Start Site40088356
End Site40093264
Strand+
Exon Number3
CNCI Score-0.0425984
Length389
Assemblyhg38
Other transcript VersionsNONHSAT053514.1(old version)

Sequence


>NONHSAT053514.1
TGGCTGTCAAGCGGGAGCAGCTCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCATCTTTGAACTGGGCAAGTCACTCTCTGCCTTTAACCTGGATGACACGGAAGTGGCTCTGCTGCAGGCTGTGCTGCTAATGTCAACAGCCGCTCGGGCCTGCTGTGTGTGGACAAGATCGAGAAGAGTCAGGAGGCGTACCTGCTGGCGTTCGAGCACTACGTCAACCACCGCAAACACAACATTCCGCACTTCTGGCCCAAGCTGCTGATGAAGTCCGGCAGCTTGAGCAGCAGCTTGGTGAAGCGGGAAGTCTCCAAGGGCCGGTTCTTCAGCACCAGAGCCCGAAGAGCCCGCAGCAGCGTCTCCTGGAGCTGCTCCACCGAAGCGGAAT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT053515.2

Data Sources

Source NameOld Id
lncipedialnc-MSL1-1-1
PMID26117828PNCT_HSA213656
noncodeV3n333225
NONCODEv4NONHSAT053514