An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054356.1

General info


NONCODE TRANSCRIPT IDNONHSAT054356.1
NONCODE Gene IDNONHSAG022062.2
Chromosomechr17
Start Site47971062
End Site47981772
Strand+
Exon Number3
CNCI Score-0.0327680
Length472
Assemblyhg38
Other transcript VersionsNONHSAT054356.1(old version)

Sequence


>NONHSAT054356.1
CGGAGGCTCGGCCACAACGCCACTGGATTGGTGGTAGGGCGGGGCGGGCCACAGTCTCCAGCCTGAAGCGGAAGTGGAGGAAAGATGGAGGACCATCAGCACGTGCCCATCGACATCCAGACCAGCAAGCTGCTCGATTGAAGCTGACATCTCCAAGAGGTACAGCGGGCGCCCTGTGAACCTGATGGGAACCTCTCTGTGACACCCTCCGTGTTCTTGCCTGCCCATCTTCTCCGCTTTTGGGATGAAGATGATAGCCAGGGCTGTTGTTTTGGGGCCCTTCAAGGCAAAAGACCAGGCTGACTGGAAGATGGAAAGCCACAGGAAGGAAGCGGCACCTGATGGTGATCTTGGCACTCTCCATGTTCTCTACAAGAAGCTGTGGTGATTGGCCCTGTGGTCTATCAGGCGAAAACCACAGATTCTCCTTCTAGTTAGTATAGCGGACTTAATAAAAGAGGAAAAAACTCTT

Expression Profile(Data Source:Human Body Map)


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA049268
PMID22140575brain_Pred18283
lncipedialnc-CDK5RAP3-1-2
NONCODEv4NONHSAT054356