An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054356.1

General info


NONCODE TRANSCRIPT IDNONHSAT054356.1
NONCODE Gene IDNONHSAG022062.1
Chromosomechr17
Start Site46048428
End Site46059138
Strand+
Exon Number3
CNCI Score-0.0830273
Length472
Assemblyhg19
Other transcript VersionsNONHSAT054356.2

Sequence


>NONHSAT054356.1
CGGAGGCTCGGCCACAACGCCACTGGATTGGTGGTAGGGCGGGGCGGGCCACAGTCTCCAGCCTGAAGCGGAAGTGGAGGAAAGATGGAGGACCATCAGCACGTGCCCATCGACATCCAGACCAGCAAGCTGCTCGATTGAAGCTGACATCTCCAAGAGGTACAGCGGGCGCCCTGTGAACCTGATGGGAACCTCTCTGTGACACCCTCCGTGTTCTTGCCTGCCCATCTTCTCCGCTTTTGGGATGAAGATGATAGCCAGGGCTGTTGTTTTGGGGCCCTTCAAGGCAAAAGACCAGGCTGACTGGAAGATGGAAAGCCACAGGAAGGAAGCGGCACCTGATGGTGATCTTGGCACTCTCCATGTTCTCTACAAGAAGCTGTGGTGATTGGCCCTGTGGTCTATCAGGCGAAAACCACAGATTCTCCTTCTAGTTAGTATAGCGGACTTAATAAAAGAGGAAAAAACTCTT

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT054357.1
NONHSAT054358.1
NONHSAT054359.1
NONHSAT054360.1
NONHSAT054361.1

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA049268
PMID22140575brain_Pred18283
lncipedialnc-CDK5RAP3-1-2
NONCODEv4NONHSAT054356