An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054401.1

General info


NONCODE TRANSCRIPT IDNONHSAT054401.1
NONCODE Gene IDNONHSAG022077.2
Chromosomechr17
Start Site48541405
End Site48542443
Strand-
Exon Number2
CNCI Score-0.0638976
Length535
Assemblyhg38
Other transcript VersionsNONHSAT054401.1(old version)

Sequence


>NONHSAT054401.1
GTCACCTCCCCGCCCCTCAGCAGAGGGTCTTTGGTCCTGAGCGGGTGGTTCTGGGGCCTCTGCTTGGAAATAGAGATGGGCAGGTCGAGGGAGAGAGTGTACAGCGAACAGAGGAGGGTGAAAGGAGAGGAAGCCTGTGGACAGTCTTCAGGGTCGTGGCGGGGGCAGAAGTTTACTGGAATTGGGAACAATCCAAGGGCTTCCTAGGCTTTTGCTTCTTATGACCGAAGCCGGTGTAGGACCTTTTTCCGAACTCAAGAAGCCTAGGGACGCGAGGCCTGGGGCTTGAGCCGGGCCTCTTTGGGAGCTTGGAGCCCAACGGACGCTGAGGACGCGAGATGGAAGGAGAGTCCGGGTGGATGTGGGAAGGGAAGGAGAGCGGCGGGTCTGCGGGCCTGGGTGTGCCTCATCCAGTCTGACTTTTGATTCTTCGCTGTGGGATTTGAAGCCAGGCCAGAGCTTTCTCTGAATGCAGACCCACCAGTCTTGACCAACAACTTCATTTCACGTATCAACACCATGTCCTGTCTATCCC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-HOXB2-1-2_dup1
PMID26117828PNCT_HSA049320
NONCODEv4NONHSAT054401
PMID26117828TCONS_00016414