An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054401.1

General info


NONCODE TRANSCRIPT IDNONHSAT054401.1
NONCODE Gene IDNONHSAG022077.1
Chromosomechr17
Start Site46618767
End Site46619805
Strand-
Exon Number2
CNCI Score-0.1561891
Length535
Assemblyhg19
Other transcript VersionsNONHSAT054401.2

Sequence


>NONHSAT054401.1
GTCACCTCCCCGCCCCTCAGCAGAGGGTCTTTGGTCCTGAGCGGGTGGTTCTGGGGCCTCTGCTTGGAAATAGAGATGGGCAGGTCGAGGGAGAGAGTGTACAGCGAACAGAGGAGGGTGAAAGGAGAGGAAGCCTGTGGACAGTCTTCAGGGTCGTGGCGGGGGCAGAAGTTTACTGGAATTGGGAACAATCCAAGGGCTTCCTAGGCTTTTGCTTCTTATGACCGAAGCCGGTGTAGGACCTTTTTCCGAACTCAAGAAGCCTAGGGACGCGAGGCCTGGGGCTTGAGCCGGGCCTCTTTGGGAGCTTGGAGCCCAACGGACGCTGAGGACGCGAGATGGAAGGAGAGTCCGGGTGGATGTGGGAAGGGAAGGAGAGCGGCGGGTCTGCGGGCCTGGGTGTGCCTCATCCAGTCTGACTTTTGATTCTTCGCTGTGGGATTTGAAGCCAGGCCAGAGCTTTCTCTGAATGCAGACCCACCAGTCTTGACCAACAACTTCATTTCACGTATCAACACCATGTCCTGTCTATCCC

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT054400.1

Data Sources


Source NameOld Id
lncipedialnc-HOXB2-1-2_dup1
PMID26117828PNCT_HSA049320
NONCODEv4NONHSAT054401
PMID26117828TCONS_00016414