An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054411.1

General info


NONCODE TRANSCRIPT IDNONHSAT054411.1
NONCODE Gene IDNONHSAG022080.2
Chromosomechr17
Start Site48557261
End Site48560333
Strand+
Exon Number2
CNCI Score-0.0421888
Length845
Assemblyhg38
Other transcript VersionsNONHSAT054411.1(old version)

Sequence


>NONHSAT054411.1
AAGGCACTACCCTGTGATTTCCTGGTTAGAATACTTGGCTTTTGCCTTCTCCCATCTGGATGCACCAGAAGAGGGAACGGGACTGGGGACAACAAAGTATTAACGAAGATTTCAAAGCTGGGAGTTGTAAAGTGGGAATTGCTAATGAAGAAGGCTCTTGGCATTTGGATCCCCATCTCCAGCTCTCCAATAAGCCAGAGCAGGAGGGAACAAAGGGGCACCCGGAAGGGAGAAGAGGAGACTCGCATAGACACTGCTCAGCAATAGTGGGGATCAAAAGAAGAAAAAGGTCGCTGCAGTGGAAGAAGAAAAATCCAAGCTGTACTTTTTCCCCACCCCACGTGTGGGGGCGCTGCCCTCTCCCCAGCTGAGCCTGTGAAGGGGTGGCAGGACAAAAAGGGCAGCCACAAGGGTCTGCGAAGTCCACTCGATGACCACGGAGGCCGCCTGAACATGCTAATGAGGGGATGGCGGTGCTGCCAGCGAGTTGGGAGCCTCAGGCAGGTGGGCTCCTTGGTGGTGATAGATCCCAATCTGAATCAGGGCTCCCGCCTCACCTAGAAGCTCAGCCTTAGCCTGGCAAACCCCACCCCCAGCAAGTGTTGAGACAAAGGTGGGCAGAGCAGAGAAGGCAGAGGAAGGGAGGCTGCAAATCCTGGGCAGCTTGGGGGCTGCAGGGGGTGCTGGGAAAGGGAGGGAGAAGCAGGAAAAGAGGAACGGGCCCAGTCCCTGAGGTTCAGCGGGCCTCTCCTGACAGACTGGATGTTTCTCTCCCAGTGACCTCTGTTTAGCAGACAATAACTCAGTGGATTAATGACCAATCAGCGAAAGGCCTTCCGAATTGC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175305.1

Data Sources

Source NameOld Id
PMID26117828TCONS_00015470
lncipedialnc-CALCOCO2-7-1_dup1
NONCODEv4NONHSAT054411
ensemblENST00000464382
gencodeENST00000464382.2
PMID26117828PNCT_HSA049329