An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054431.1

General info


NONCODE TRANSCRIPT IDNONHSAT054431.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48590419
End Site48602341
Strand+
Exon Number4
CNCI Score-0.0057344
Length772
Assemblyhg38
Other transcript VersionsNONHSAT054431.1(old version)

Sequence


>NONHSAT054431.1
GTCATAGCGACTTTTGGGATAGTTTGCTATCGACAAAGGGAGACAAAGTCAAGGGGTGAAGGGAAAGGAGGGCCAAGTAGAGCCTCCACGACCCTCGGCTTCCTCCTCACCAGCTCCCCCTCCCTCCAAGTCCAGTAAGAAGTTGGGCCAAGCTGGAAGGGATTGACCGGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTCCAGGGGACAACCTGAGGGCCCTGAAGTGTTTCAATACCATGTACCAGCTTGACTTCTCTACATGTCCTTTGGATTGCCCAAAAGCAAAATCTCAGAGGGGCCAAGGACCTTCTAGGGCTGGCTCCCTCAGGGCCTCCTATAGAGCAGCTCCTTGAGTCGGGCCTTATAGCCACCAGAAAGTCACCTCGCCGCAGGAAAGCTATAAAGAGCTGCTCCAGAGGCGCCGAAAGAGGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054442.2
NONHSAT054443.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA049333
ensemblENST00000476204
lncipedialnc-CALCOCO2-8-10_dup1
refseqNR_110331
NAMEHOXB-AS3
NONCODEv4NONHSAT054431
gencodeENST00000476204.4