An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054431.1

General info


NONCODE TRANSCRIPT IDNONHSAT054431.1
NONCODE Gene IDNONHSAG022078.1
Chromosomechr17
Start Site46667781
End Site46679470
Strand+
Exon Number4
CNCI Score-0.0559610
Length539
Assemblyhg19
Other transcript VersionsNONHSAT054431.2

Sequence


>NONHSAT054431.1
GTCATAGCGACTTTTGGGATAGTTTGCTATCGACAAAGGGAGACAAAGTCAAGGGGTGAAGGGAAAGGAGGGCCAAGTAGAGCCTCCACGACCCTCGGCTTCCTCCTCACCAGCTCCCCCTCCCTCCAAGTCCAGTAAGAAGTTGGGCCAAGCTGGAAGGGATTGACCGGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTCCAGGGGACAACCTGAGGGCCCTGAAGTGTTTCAATACCATGTACCAGCTTGACTTCTCTACATGTCCTTTGGATTGCCCAAAAGCAAAATCTCAGAGGGGCCAAGGACCTTCTAGGGCTGGCTCCCTCAGGGCCTCCTATAGAGCAGCTCCTTGAGTCGGGCCTTATAGCCACCAGAAAGTCACCTCGCCGCAGGAAAGCTATAAAGAGCTGCTCCAGAGGCGCCGAAAGAGGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT054403.1
NONHSAT054405.1
NONHSAT054406.1
NONHSAT054407.1
NONHSAT054408.1
NONHSAT054432.1
NONHSAT054433.1
NONHSAT054434.1
NONHSAT054435.1
NONHSAT054436.1
NONHSAT054437.1
NONHSAT054441.1
NONHSAT054442.1
NONHSAT054443.1
NONHSAT054444.1
NONHSAT054446.1
NONHSAT054449.1
NONHSAT054450.1

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA049333
ensemblENST00000476204
lncipedialnc-CALCOCO2-8-10_dup1
refseqNR_110331
NAMEHOXB-AS3
NONCODEv4NONHSAT054431
gencodeENST00000476204.4