An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054432.1

General info


NONCODE TRANSCRIPT IDNONHSAT054432.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48590441
End Site48601921
Strand+
Exon Number3
CNCI Score-0.0626688
Length741
Assemblyhg38
Other transcript VersionsNONHSAT054432.1(old version)

Sequence


>NONHSAT054432.1
TTTGCTATCGACAAAGGGAGACAAAGTCAAGGGGTGAAGGGAAAGGAGGGCCAAGTAGAGCCTCCACGACCCTCGGCTTCCTCCTCACCAGCTCCCCCTCCCTCCAAGTCCAGTAAGAAGTTGGGCCAAGCTGGAAGGGATTGACCGGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTCCAGGGGACAACCTGAGGGCCCTGAAGTGTTTCAATACCATGTACCAGCTTGACTTCTCTACATGTCCTTTGGATTGCCCAAAAGCAAAATCTCAGAGGGGCCAAGGACCTTCTAGGGCTGGCTCCCTCAGGGCCTCCTATAGAGCAGCTCCTTGAGTCGGGCCTTATAGCCACCAGAAAGTCACCTCGCCGCAGGAAAGCTATAAAGAGCTGCTCCAGAGGCGCCGAAAGAGGGTGAGGGCTGCAGCCACAGTGTTTGTCCCCAGCACCACCAGGCCCCTTAACCTCGTCAGCTCCTCTAGCCCTCGGCCAGACTCTGGCAACACCTTGGTTTGCCTGGCACCGCAGGCAATTTCCTGGAACCCCACCCCCACCCAGGAACGGGGACCACAGCACCTTTAAAGGAACTGCCAGAGCTTCCTCCTACGGCTTGAAAGCCCAAGCTAATCAGTAACCCGTGAGACAGGGGCCAATATTCAAACGCTGCAGCAG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054442.2
NONHSAT054443.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT054432
gencodeENST00000474040.4
lncipedialnc-CALCOCO2-8-11_dup1
PMID26117828PNCT_HSA049334
ensemblENST00000474040