An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054432.1

General info


NONCODE TRANSCRIPT IDNONHSAT054432.1
NONCODE Gene IDNONHSAG022078.1
Chromosomechr17
Start Site46667803
End Site46679283
Strand+
Exon Number3
CNCI Score-0.1537381
Length741
Assemblyhg19
Other transcript VersionsNONHSAT054432.2

Sequence


>NONHSAT054432.1
TTTGCTATCGACAAAGGGAGACAAAGTCAAGGGGTGAAGGGAAAGGAGGGCCAAGTAGAGCCTCCACGACCCTCGGCTTCCTCCTCACCAGCTCCCCCTCCCTCCAAGTCCAGTAAGAAGTTGGGCCAAGCTGGAAGGGATTGACCGGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTCCAGGGGACAACCTGAGGGCCCTGAAGTGTTTCAATACCATGTACCAGCTTGACTTCTCTACATGTCCTTTGGATTGCCCAAAAGCAAAATCTCAGAGGGGCCAAGGACCTTCTAGGGCTGGCTCCCTCAGGGCCTCCTATAGAGCAGCTCCTTGAGTCGGGCCTTATAGCCACCAGAAAGTCACCTCGCCGCAGGAAAGCTATAAAGAGCTGCTCCAGAGGCGCCGAAAGAGGGTGAGGGCTGCAGCCACAGTGTTTGTCCCCAGCACCACCAGGCCCCTTAACCTCGTCAGCTCCTCTAGCCCTCGGCCAGACTCTGGCAACACCTTGGTTTGCCTGGCACCGCAGGCAATTTCCTGGAACCCCACCCCCACCCAGGAACGGGGACCACAGCACCTTTAAAGGAACTGCCAGAGCTTCCTCCTACGGCTTGAAAGCCCAAGCTAATCAGTAACCCGTGAGACAGGGGCCAATATTCAAACGCTGCAGCAG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT054403.1
NONHSAT054405.1
NONHSAT054406.1
NONHSAT054407.1
NONHSAT054408.1
NONHSAT054431.1
NONHSAT054433.1
NONHSAT054434.1
NONHSAT054435.1
NONHSAT054436.1
NONHSAT054437.1
NONHSAT054441.1
NONHSAT054442.1
NONHSAT054443.1
NONHSAT054444.1
NONHSAT054446.1
NONHSAT054449.1
NONHSAT054450.1

Data Sources


Source NameOld Id
NONCODEv4NONHSAT054432
gencodeENST00000474040.4
lncipedialnc-CALCOCO2-8-11_dup1
PMID26117828PNCT_HSA049334
ensemblENST00000474040