An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054434.1

General info


NONCODE TRANSCRIPT IDNONHSAT054434.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48590419
End Site48602341
Strand+
Exon Number3
CNCI Score-0.0286720
Length536
Assemblyhg38
Other transcript VersionsNONHSAT054434.1(old version)

Sequence


>NONHSAT054434.1
GTCATAGCGACTTTTGGGATAGTTTGCTATCGACAAAGGGAGACAAAGTCAAGGGGTGAAGGGAAAGGAGGGCCAAGTAGAGCCTCCACGACCCTCGGCTTCCTCCTCACCAGCTCCCCCTCCCTCCAAGTCCAGTAAGAAGTTGGGCCAAGCTGGAAGGGATTGACCGGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054442.2
NONHSAT054443.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
refseqNR_033202
NAMEHOXB-AS3
gencodeENST00000480872.4
noncodeV3n409095
ensemblENST00000480872
PMID26117828PNCT_HSA214644
NONCODEv4NONHSAT054434
lncipedialnc-CALCOCO2-8-8_dup1