An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054435.1

General info


NONCODE TRANSCRIPT IDNONHSAT054435.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48592291
End Site48602341
Strand+
Exon Number3
CNCI Score-0.0286720
Length439
Assemblyhg38
Other transcript VersionsNONHSAT054435.1(old version)

Sequence


>NONHSAT054435.1
GGAACCAGATCTTGATCTGGCGCTCGGACAGGCAGAGTGCGTGGGCGATCTCGATGCGCCGTCGCCGGGTCAGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054442.2
NONHSAT054443.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA214645
NONCODEv4NONHSAT054435
noncodeV3n409096
ensemblENST00000429755
gencodeENST00000429755.7
lncipedialnc-CALCOCO2-8-16_dup1
refseqNR_033203
NAMEHOXB-AS3