An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054435.1

General info


NONCODE TRANSCRIPT IDNONHSAT054435.1
NONCODE Gene IDNONHSAG022078.1
Chromosomechr17
Start Site46669653
End Site46679703
Strand+
Exon Number3
CNCI Score-0.0787186
Length439
Assemblyhg19
Other transcript VersionsNONHSAT054435.2

Sequence


>NONHSAT054435.1
GGAACCAGATCTTGATCTGGCGCTCGGACAGGCAGAGTGCGTGGGCGATCTCGATGCGCCGTCGCCGGGTCAGGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT054403.1
NONHSAT054405.1
NONHSAT054406.1
NONHSAT054407.1
NONHSAT054408.1
NONHSAT054431.1
NONHSAT054432.1
NONHSAT054433.1
NONHSAT054434.1
NONHSAT054436.1
NONHSAT054437.1
NONHSAT054441.1
NONHSAT054442.1
NONHSAT054443.1
NONHSAT054444.1
NONHSAT054446.1
NONHSAT054449.1
NONHSAT054450.1

Data Sources


Source NameOld Id
PMID26117828PNCT_HSA214645
NONCODEv4NONHSAT054435
noncodeV3n409096
ensemblENST00000429755
gencodeENST00000429755.7
lncipedialnc-CALCOCO2-8-16_dup1
refseqNR_033203
NAMEHOXB-AS3