An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054441.1

General info


NONCODE TRANSCRIPT IDNONHSAT054441.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48595957
End Site48602341
Strand+
Exon Number3
CNCI Score-0.0286720
Length532
Assemblyhg38
Other transcript VersionsNONHSAT054441.1(old version)

Sequence


>NONHSAT054441.1
GGCTTTGGGGAGGGGGTGGGAGAGACGACAGGTCTGGGATCAGGGAGTCTTCAAGGCCCCCGCTGAGGGGACAGCGAATCTACCATTGAACCGTGCACGGGGGACATGGACAAAATGAGACGCGACAGGGACAAGAGCATTTTGCTCTGCTTCCAGGAAACATCAAGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054442.2
NONHSAT054443.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
noncodeV3n409098
NONCODEv4NONHSAT054441
refseqNR_033205
NAMEHOXB-AS3
gencodeENST00000481995.4
PMID26117828PNCT_HSA214650
ensemblENST00000481995
lncipedialnc-CALCOCO2-8-23_dup1