An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054441.1

General info


NONCODE TRANSCRIPT IDNONHSAT054441.1
NONCODE Gene IDNONHSAG022078.1
Chromosomechr17
Start Site46673319
End Site46679703
Strand+
Exon Number3
CNCI Score-0.0787186
Length532
Assemblyhg19
Other transcript VersionsNONHSAT054441.2

Sequence


>NONHSAT054441.1
GGCTTTGGGGAGGGGGTGGGAGAGACGACAGGTCTGGGATCAGGGAGTCTTCAAGGCCCCCGCTGAGGGGACAGCGAATCTACCATTGAACCGTGCACGGGGGACATGGACAAAATGAGACGCGACAGGGACAAGAGCATTTTGCTCTGCTTCCAGGAAACATCAAGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT054403.1
NONHSAT054405.1
NONHSAT054406.1
NONHSAT054407.1
NONHSAT054408.1
NONHSAT054431.1
NONHSAT054432.1
NONHSAT054433.1
NONHSAT054434.1
NONHSAT054435.1
NONHSAT054436.1
NONHSAT054437.1
NONHSAT054442.1
NONHSAT054443.1
NONHSAT054444.1
NONHSAT054446.1
NONHSAT054449.1
NONHSAT054450.1

Data Sources


Source NameOld Id
noncodeV3n409098
NONCODEv4NONHSAT054441
refseqNR_033205
NAMEHOXB-AS3
gencodeENST00000481995.4
PMID26117828PNCT_HSA214650
ensemblENST00000481995
lncipedialnc-CALCOCO2-8-23_dup1