An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054442.1

General info


NONCODE TRANSCRIPT IDNONHSAT054442.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48595959
End Site48601892
Strand+
Exon Number3
CNCI Score-0.0983040
Length728
Assemblyhg38
Other transcript VersionsNONHSAT054442.1(old version)

Sequence


>NONHSAT054442.1
CTTTGGGGAGGGGGTGGGAGAGACGACAGGTCTGGGATCAGGGAGTCTTCAAGGCCCCCGCTGAGGGGACAGCGAATCTACCATTGAACCGTGCACGGGGGACATGGACAAAATGAGACGCGACAGGGACAAGAGCATTTTGCTCTGCTTCCAGGAAACATCAAGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTCCAGGGGACAACCTGAGGGCCCTGAAGTGTTTCAATACCATGTACCAGCTTGACTTCTCTACATGTCCTTTGGATTGCCCAAAAGCAAAATCTCAGAGGGGCCAAGGACCTTCTAGGGCTGGCTCCCTCAGGGCCTCCTATAGAGCAGCTCCTTGAGTCGGGCCTTATAGCCACCAGAAAGTCACCTCGCCGCAGGAAAGCTATAAAGAGCTGCTCCAGAGGCGCCGAAAGAGGGTGAGGGCTGCAGCCACAGTGTTTGTCCCCAGCACCACCAGGCCCCTTAACCTCGTCAGCTCCTCTAGCCCTCGGCCAGACTCTGGCAACACCTTGGTTTGCCTGGCACCGCAGGCAATTTCCTGGAACCCCACCCCCACCCAGGAACGGGGACCACAGCACCTTTAAAGGAACTGCCAGAGCTTCCTCCTACGGCTTGAAAGCCCAAGCTAATCAGTAACCCGTGAGA

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054443.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
NONCODEv4NONHSAT054442
ensemblENST00000460041
gencodeENST00000460041.4
lncipedialnc-CALCOCO2-8-26_dup1
PMID26117828PNCT_HSA049337