An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054443.1

General info


NONCODE TRANSCRIPT IDNONHSAT054443.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48595957
End Site48602341
Strand+
Exon Number2
CNCI Score-0.0376832
Length433
Assemblyhg38
Other transcript VersionsNONHSAT054443.1(old version)

Sequence


>NONHSAT054443.1
GGCTTTGGGGAGGGGGTGGGAGAGACGACAGGTCTGGGATCAGGGAGTCTTCAAGGCCCCCGCTGAGGGGACAGCGAATCTACCATTGAACCGTGCACGGGGGACATGGACAAAATGAGACGCGACAGGGACAAGAGCATTTTGCTCTGCTTCCAGGAAACATCAAGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCTTCG

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054442.2
NONHSAT054444.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
PMID26117828PNCT_HSA049336
lncipedialnc-CALCOCO2-8-24_dup1
refseqNR_110330
NAMEHOXB-AS3
gencodeENST00000474324.1
NONCODEv4NONHSAT054443
ensemblENST00000474324