An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054444.1

General info


NONCODE TRANSCRIPT IDNONHSAT054444.1
NONCODE Gene IDNONHSAG022078.2
Chromosomechr17
Start Site48595979
End Site48602338
Strand+
Exon Number4
CNCI Score-0.0057344
Length743
Assemblyhg38
Other transcript VersionsNONHSAT054444.1(old version)

Sequence


>NONHSAT054444.1
AGACGACAGGTCTGGGATCAGGGAGTCTTCAAGGCCCCCGCTGAGGGGACAGCGAATCTACCATTGAACCGTGCACGGGGGACATGGACAAAATGAGACGCGACAGGGACAAGAGCATTTTGCTCTGCTTCCAGGAAACATCAAGTTGCTTGTCTGGAGATGGAGCCACTACAGGCGGGCCTGGGCGCCTGGAGTCGGGCATGAAAGAAAATAGCGCCTCATCGCTCTTATCTAAGCCCAGAGGTCCAGGGGACAACCTGAGGGCCCTGAAGTGTTTCAATACCATGTACCAGCTTGACTTCTCTACATGTCCTTTGGATTGCCCAAAAGCAAAATCTCAGAGGGGCCAAGGACCTTCTAGGGCTGGCTCCCTCAGGGCCTCCTATAGAGCAGCTCCTTGAGTCGGGCCTTATAGCCACCAGAAAGTCACCTCGCCGCAGGAAAGCTATAAAGAGCTGCTCCAGAGGCGCCGAAAGAGGGTAGACTTCGCTTGAAAAGATCGAGAATGGAGGAGGGGATCGGCACTCACTTGCAGACATCAACAGTTTCCAGAAAATTCGGTTCAATTCCTTCACCACGGACCCACCAACCAAGGAGCTGGCAAAACCCACTAACCAACCAGGAGAACACAGACCCGGTTTGTCTTTTGACAACCGAGTGGAACTGACGGGGCCGGCGCCTGCCCTGCGGGTCCCCTCCCTTGGCTGAGAAGAAAACCAAATAAACCTTGAACAGCCTTGGCT

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT175303.1
NONHSAT175304.1
NONHSAT054403.2
NONHSAT054405.2
NONHSAT054406.2
NONHSAT054407.2
NONHSAT054408.2
NONHSAT054431.2
NONHSAT054432.2
NONHSAT054433.2
NONHSAT054434.2
NONHSAT054435.2
NONHSAT054437.2
NONHSAT054441.2
NONHSAT054442.2
NONHSAT054443.2
NONHSAT054446.2
NONHSAT054449.2
NONHSAT054450.2

Data Sources

Source NameOld Id
lncipedialnc-CALCOCO2-8-28_dup1
NONCODEv4NONHSAT054444
PMID26117828PNCT_HSA049338
gencodeENST00000477144.1
ensemblENST00000477144