An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054705.1

General info


NONCODE TRANSCRIPT IDNONHSAT054705.1
NONCODE Gene IDNONHSAG022195.1
Chromosomechr17
Start Site48704392
End Site48709301
Strand-
Exon Number2
CNCI Score-0.2288835
Length510
Assemblyhg19
Other transcript VersionsNONHSAT054705.2

Sequence


>NONHSAT054705.1
ACTTTGCTTTTGAGTGTTCAGAACCAAGATGGTTCTTGCTGGAAGGGCTCCGGAGAAGCAGTAACGGCCTTGTGGGTTGGGCTGCAGCAGAGAAATGGACCAAACCTCCCCCAGCCTTCATGGCCCAAGCCCCATCCTCCCTCCCCAACTGACTGCTGCTCCAGGCAGGATGGATGGAGCATGTGCGGTGCCTCCCCCGCAAAAATGATGACGAGGTTAAAGGAAAAAATAAGTTACATTACAGTTTCCAAAATGGTTCTCGCTCTCCGCTGAAGATGGGCCACCGTTGGGGCTGCAATGTGCTCGCGGTCCCAGCTTGTGCTTTGCAAGAAGAGGGAATATAACTAGACTGTTATTTTAGGTTAAAATAGCCAAGAGACAGACGCCTTCGCCTCAAAAATATTCTGAGACACATAAAAGTAGAAGGAAACAAGTCTCTTCAGTCACAAAATGTCGTACATCCCGCATATACTAGATTCAATTAATTTAATAAAATAGAATATACATAGA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n340746
ensemblENST00000502435
noncodeV3Human
PMID26117828PNCT_HSA214799
lncipedialnc-ANKRD40-2-1_dup1
NONCODEv4NONHSAT054705
PMID26117828TCONS_00015902
gencodeENST00000502435.1