An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT054726.1

General info


NONCODE TRANSCRIPT IDNONHSAT054726.1
NONCODE Gene IDNONHSAG022208.1
Chromosomechr17
Start Site48917417
End Site48918987
Strand-
Exon Number2
CNCI Score-0.2007359
Length459
Assemblyhg19
Other transcript VersionsNONHSAT054726.2

Sequence


>NONHSAT054726.1
AGGCAAGCCGACCACCACCCAAAGGCACCCGTTTCAGCAGCTTCCATTCAGGGCAAGTCATATGCTGGGCTGGACTCTGCCGCCAGCTTGCTATTGCCCATGCCCCTAACTCCGAGTGGCCTCTGCTCACAGCAATCGAGGAGGCTGTGGGAAAGGTGTGAAGGTCAGGCAGTTGTTGGCCTGGGCATCGAAGTGCCAGCGGGTCTGCTCTTCGCCACAGTCCTCACTGTCTGGGGGCTTCAGGCACTCGGCCGCCGGGAAAGCCGTGCCATTGGGGCTGCTCTCTGAGGTGGCTGCAGCCTGATGACCCCTGACCACCGACAGCGGGAAATCAGCCCTCAGGACCCCAGCCACGTTCCGGGCCGTGCAGGTGTAGATCCCAGCATCCTGCAGCTGGGCGTTATAGATGACCAGCTGGGCAATGTTGGTGACCACCACGTTGCCACGCACATGGTTGGG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT054725.1

Data Sources

Source NameOld Id
lncipedialnc-TOB1-1-1
PMID26117828PNCT_HSA049631
PMID26117828TCONS_00015906
NONCODEv4NONHSAT054726