An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT055174.1

General info


NONCODE TRANSCRIPT IDNONHSAT055174.1
NONCODE Gene IDNONHSAG022434.1
Chromosomechr17
Start Site60783594
End Site60815276
Strand+
Exon Number3
CNCI Score-0.1128613
Length3145
Assemblyhg19
Other transcript VersionsNONHSAT055174.2

Sequence


>NONHSAT055174.1
AGCTTTAGTCCCTGGGACCGTTTCTGTGCCCAAGGAGAGGGAGGGCAGGGGAAGGATGGAATTTCATCTAGAGTAGCAGGTCCTGGTTGCCTGGTAAATTATGCATCAGGACTGGGCTAGCCACTGCCTCCGTTTTCTCTGGGCTCCTGAGATAACCTCCACCTGCCTCTAGATTCTGTGCCAGCTGATCGTTATCTATCTCATCAACTCTTGTTCCATCAGGAAACTGCATCTTGGTGGATGATGAACCAATAAACCTGGACACAATCTCCCGAATAACACCACACATGCCAACAAATGACATCAGCATTCCAGAATGTAAGCGGCTGGAATCTGATGAAGATAAGAACTAACGAAAATCCCACATGAGTCATGCTAATATACACAAAGAGGGCTCAAATTCCAAGAATCAATTTCCAGATCAGTAAGCCAAGATCAGAGCATGGTAAACACCTATCATAAATGAAATGGTAGAATCCTGACATGGTGTTTAATGATGGCTTTACAAAGTATCACATTTCATAGCTGTGAACTATCCCCAAATCATCTCACAAAAAAGGAAAGATCAAAGAAAAGGGCAATTCAGAAAAGATCTTATTTCTCTCTCTCTCTTGCATGAAAAAGAGCACATAAAATAGAAGCAGTGGTTACCCCAGCGTGGCCCTTCAGAGAACCGAGGTAACTATGGTAACTAAGAACGGTCTTTTAGTTCGCAAGGTTCGAATTCTAGAACTGTTGGTTGGATTTGGGGTAAGTCCCATAAGGGAGAGCTGCGAACTTCAAGTGTGGACTGGTTCATTCTCTAGGGAGATAGCAACCTTTTCCTAAAAAATCTTGGTTCTTCATTGCTGGAGAGAAGAACAAGCCCTGTGAAGCAGTCAGAGATCCTTATACCCAGCAGACTTAAGGGTGTGGTATTCAAGGAAAAAAACACTTTGGGAAATAGAGAAGAAACTGATCAGGAACACCAGACTTTTCTTTATAAATACGTATATTTTAAGAGCAACAAAACAGAGACAATTTTCTCAAAATAAGCAACCACTAAAATGTCAAGGAAGGACCCATTTATGACTTAAAATTCCCATGGCTCTCTAACGAAAGCAATGCTAATTTTGGCCTTGGGAAAGTGGAAAAAATATATAATTATGAAAAGTCCTCACCTTTCTTGCAATTTCTTGAGTTTCTCAGGGTCTGCCTTTATCTTACTGGTTTCCTTTTCATCTGTGAAACCAGAGGCTGCCATCCTGCTCCCATTATCATTTTGATTTGGGAAATGAGACACTGCAAAGAAAGTAAATGGTGTATTTTCTTGCAGAGACCCAGACACATGCAAATGGCCTTCTGAGTTCATTCTTGATGGAGAGGAGCTGGAAGAATCCACTAAGGACAAATTGCCCTGTGGATTTAGTAAGAGATCTGTATATAGTGGAGCCCCCTGAGGCTGGCTTGTTAAAGTAGTATCTTCTGCTTCCCTGACAGCAAATTCGTGTGCACTGTTTACTGGGAAATAATTATGGTTTTCGGCACTGGCAAATGGAGTCCTATTTCTAATGGGAGACAGTGGTTGGCAAACATGAAACCCTGAGTTTCCCTCTGAGTCTGAGCTGTGAACTGAAGTCGATGACATTGACAAGTCTACTGGAATATCATCTCTCAGAGCAGAATGCATGAATGATGCAGGAGGGTTATAGGATGAATTCACTGATGATCTTGGAGATATTGGTCTGCCAGAAATAAAGTAGTCAAGAGAATTTTGAGAACTGTTTAAATAGTCTTTCCAGTATCCTTCAGAATCATGGGTGCCAGGCCTATGTTCCACAGAAATACAATCACTCCATACATTTTCAGCATTGACACCAACCTCTTGTCTGGGCTCGGATTTGGTGTCCCACGAAAGAGGGCTCTTTTTCGCATTTTCACTGCCACCTCTGTCCTTCTCTGTAGCAGATTCCCTATCAGGCAGCCCGGGGTCTTGGGACAACCTTTGCCCAGCAGAAGGCCGCTCTGTTGCTGGCTCCATTGCATTGCTTATTCTCAATGAGCCATGACTGGGCTCACTTCTTCTTGAAGAATGACCTCTGCAATTTTCAGCATTTTCTTCAAAATTTTTATTTTTGGCCTGAGGGGTCGATGTCCCCCCAAATCTACTTCTTTTGTGATGGGAAGGAGAACAGGGTGAGCGCACACCAACCCACAGACATTCTTCAGACTGGGTTTCCTCTTCAGTGTCATCGCTTTCTCTTCTGCTGTTCAATGACAAAATGGAATAAAAGTCTTCATCTCGGAACCTAAATGATGCCTTTCTTGGCCCTCCTACAGTGGTGGGTGTGAGTGGTGGCCCCGAGAACTCACTCAATACTTGAGGACTATTTTTTCCTTGGAAGGCCTGGGACAGGGCTGGATGCAGCTCACTCTGGGAAGGAGCACTCGGGTCTCCTTTTTTGGCTCTATCAGGGGCGTTCTCAGTCATTGGCTGTGACGATGGGACCAAGTTTCTTCTCTCTTGATTTGGCCTCTTCAGCTTAGTGTTACACATCAGGCCTTCTTGTTGAACTACTTGATCTGCATTGAGAAAAGACACATTTATCGTTCCAGTAAAAGGGCCCATGGATGAAAGGCCTCTAGCACCAAGTGCAAAATTGCCCTTTAAATGCAACAGACAAGACCTAGAGAAGAAAACAGACACGGTCAAAATGGCTGGAGGTACAAGAGGAGCAGAGCCCAGCAGGCTTCATTTTACTGCCCCGTATTCTCCTTTGTACCCCTGTGGTCCTAGGGAAATGGGGGGACCCTGAGGATACAGATTCTTTCTGCAGAAGCTCCCGGAAGACTGGCCCAGCCCCAGCCAGTCAGGACTGATGATGCGCAAACCTCACACTAAATACTGGCTTTTGTTCCATACGTACTGAAAGGGAAAACCACCACTCTGGGAATGACTTCTACAAAAACCACCAGCCCTTTCTCATCCACGTTCATTCAATGTACATTTATGACACCCTGCCTCCCACGCAGCTTTACAAGAACTTAAGAGAAGTATAACATGTCTTGGCAGATCAGGAGGAAGGCTATAGGAGCTGGCGCCCGGGGAACACTGGGGATTTTGGTCATGTTTACTATTTAGTGAAAATAAAAATTATAAATCGCT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID
NONHSAT055171.1
NONHSAT055173.1
NONHSAT055175.1

Data Sources

Source NameOld Id
ensemblENST00000577270
PMID26117828PNCT_HSA050165
PMID26117828TCONS_00015535
gencodeENST00000577270.1
lncipedialnc-MRC2-1-3_dup1
NONCODEv4NONHSAT055174