An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT055403.2

General info


NONCODE TRANSCRIPT IDNONHSAT055403.2
NONCODE Gene IDNONHSAG022551.2
Chromosomechr17
Start Site67032408
End Site67033290
Strand-
Exon Number2
CNCI Score-0.0356352
Length229
Assemblyhg38
Other transcript VersionsNONHSAT055403.1(old version)

Sequence


>NONHSAT055403.2
GGGCGAGGGGGCGGGTCGGGAGGAGGGAGAGAAGGTGGGCACAGGAAGATGGGATGGACGATGACATCATCACTAGGCCGAACGGACCTGGGTCTGAACCCCAGGGGGCCGAGTCCACCCATGGGCTGTGAGCAGGTAGCTGAGGCAAGGATGCGCTCGTTATTTCCAAGCACAACAGCTACCAGGACTACAGGCGACTGTTCCAGGGTGGATCAAGGAGTCTCAAAAA

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00010.46480000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0000002.471310
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0000.2973251.975471.1074400
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
0018.0781022.4674
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
35.10620022.35720
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset