An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT057323.2

General info


NONCODE TRANSCRIPT IDNONHSAT057323.2
NONCODE Gene IDNONHSAG023372.2
Chromosomechr18
Start Site11620716
End Site11621158
Strand-
Exon Number2
CNCI Score-0.0004096
Length296
Assemblyhg38
Other transcript VersionsNONHSAT057323.1(old version)

Sequence


>NONHSAT057323.2
GAAGGGCTGCCTACAAGCCTCACAGTCCCATCCCTGTTGGGACAATTCCAAATGAAGGCCTTAAATGATGCTCAGCTAAGCTGGTTCTTGTGTGGCCTCTGTACCTTCAAAAGCTGCCGAGTCCTATGATTACACGTGATGGGACTTGTACACTTGAAGTGAAACACAGTTTTAAAACTTGCTTTGTTTAGAATTCCCACCTCATTTTTCCATGGACAAAAGTATTCTTTATGTCCTAGTGCACTTACAATTTGGTATTACCTGGGAGTGAAAAGAAATATTACAGCCATGCCCAA

Expression Profile(Data Source:Human Body Map)


adiposeadrenalbrainbrain_Rbreastcolon
2.223019.888042.318950.7660633.74662.12789
foreskinheartheart_RHLF_1HLF_2kidney
0.04268170.765593000.8924771.69195
liverliver_RlunglymphNodeovaryplacenta_R
0.39468702.452341.930346.302730.716648
prostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
3.037660.7472163.083242.399772.72780.651961
Loading...


Exosome Expression Profile(Data Source: NCBI GEO)


A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
00004.81487
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
6.182970010.84150
Loading...



Structure Visualization


DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset