An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT058480.1

General info


NONCODE TRANSCRIPT IDNONHSAT058480.1
NONCODE Gene IDNONHSAG023456.1
Chromosomechr18
Start Site14089933
End Site14091018
Strand+
Exon Number1
CNCI Score-0.0192152
Length1085
Assemblyhg19
Other transcript VersionsNONHSAT058480.2

Sequence


>NONHSAT058480.1
ACCGGGCAGAGCCGTGATGGCTGCGGTGCAATGGAGGGACTGCAATCCTCTGTAGAGCTGAGGCCTGGGCTGACCCCTTGGGAAGCTGGACGAGGTGACTGTGGAGATGCTCGGTCCACGACTCACCTTCCATAGCCTCCAGGGGTAGACACCGGTGTGTCCACCGCTCACTGGCTCATGGGTTGGTCCCTTATTTTTATTGAGACCTGTTCAATCTGTTAGAAACTGACTTTACATAAGGCATGAAAAGCAGCCTGCGGAATCACTAGCTACACAGATTGAGGATAAATACCAACTCACTGACAAACGGCACTTGTGTTCAGAGTGTTCAGAGACGGAGTCATTTTTAGAAATGCCAGGCTAGAGAGTGTTTCAGTATAGCCACCCTTGCCGAGGCTTACAGAAGGGCAAAGACCACCATCTCAAGATTGATGGAAGAATCAGTTTTCTTGGTTCAAGAAATGAAGACGGAGAAATACAAATGTTCTAAACAAGAAGAGGTGACAGACGAGAGGCTAAAAATGCTAGAGTTCCTAGAAGAGCTCATAGGAATCACCCCATCACAAGCAATCTTTCCAAACCTCCCAGGAGGCCAAGAGCCAAGCAAGCCCTGCTGGTCCCTTCCCCAGGAGTGGGCCTGGGTCTTAAAGAGTGCTGCCCCTCCCCTCCACTCAGGCCTCCCAAGCTGCCAGGTGCATTCACTCACTTCGACTCCATCTGAGGGTCCAGGGGAGCCCCTTCCTGGGCTGGAGTTCCTCCCCCATCACATGCTGGACACAGCAGTCGGCTCCTTCATGGGCAATTTCTCCAAATTTAAAGAAGACTGGAGATCCCGGAACACAGCAAGAAATGTGAAAGTTTCTCAGAAAGTTTGATTCGCTCTCATTGGCAGTGAAAGAAATGCTATACTTGAGACACTAATCTCTTCCTCAAATTGAAACATCATCAAAGTACATTTCTCAAGATAAAGCTCTGCAAATGTTAACTATATAAGTAAATAATTTACATTTTATTCTCCAATTATTGTATTATACTTTGAAAATATATGCAGTTTGTTAATAAAGACTTTTAGTACTCAATAGCAA

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n339804
gencodeENST00000591211.1
NONCODEv4NONHSAT058480
PMID26117828TCONS_00018034
lncipedialnc-MC5R-8-1_dup1
noncodeV3Human
ensemblENST00000591211