An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT058971.2

General info


NONCODE TRANSCRIPT IDNONHSAT058971.2
NONCODE Gene IDNONHSAG023705.2
Chromosomechr18
Start Site36273573
End Site36274599
Strand+
Exon Number1
CNCI Score-0.0233472
Length1026
Assemblyhg38
Other transcript VersionsNONHSAT058971.1(old version)

Sequence


>NONHSAT058971.2
ATGATCCTCCTACCCTGTAACTCCCACAGTAACTAGCTGCTCTACACCGGCTTCAGCCAAGACCACGGATGCCTTGCTTGTGGGATGGAAAACGGATTCTGAGTCTATAACACCAATCCATTAAAATAAAAAGAGAAACAAATTTCTAGGAGGAAGAGTTGGTCATAATGAAATGTTATTTTGCTGCAACTATTTAGCTTTAGTTGTTGGTGGAAAAAAGCCAAAATACCTTCCCAACAAAGTGATGATCTGAGATGACTGAAAAAGAAGACTGTTAATGAAATAGAATTTGCTACAGAAGTCAAGGCAGTCAAATTGCAGCGAGATAGAATTGTGGTTGTTTTGGACTCCATGATTAAGGTGTTTGCACTCACACAGAACCCCCATCAGTTGTACATCTTTGAAACCTCCTAAAACCCTAAAGGCCTCTGTCCTCTGTCCCAATAGCAACAACTCTCTTCTGGCCTTGCCAGGCATGCACACGAGCCATGTTCAGCTCGTGGACTGGGCCAGCACAGAGAAGCCACCTGTGGACATTCCCGCTCCTGAGGGCATCCTGAGCTGCATGATACTCAACCTGCAGGGAACAAGAATTGCAACCACACTCGCAAAAGGGACCCTTATAAGAATATTTGATACCTCATCAGGACATTTAATCCAGGAACTATGAAGAGGATCTCAAGCAGCTAATGTTTTCTGCATTAACTTCAATCAAGATGAGTCCTTCATCTGCATATCCAGTGACCACAGCACAGTGCACATTTTTGCAGCTGAAGACCCAGGGAGGAAAAAACAGTCCAATTTGGTGTCAGCTAGTTTCCTTCCAAAATCCTTTAGTTGCAAAGGGGTTTCTCCAAGTTTCAGGTTCCCTTGGGCTCTCCATGCATTTGTGCCCTTGGAACAGAGCCAAATGTGGTCACTGCGATTTGTGCAGATGTCGGCTACTACAAATTCCTATTCAACCCCAGAAGGGAATGCATCCCAGACATCTATGCGCAGTTTCTAGAAATGATCTACGACAAGCTG

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
0.5131280.04047790.04002460.043691700.22040700
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
0.6092180.1002970000.18902300
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
15.71174.597230011.4339
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
10.3307009.383260
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-MOCOS-1-1
ensemblENST00000589678
NONCODEv4NONHSAT058971