An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT059705.2

General info


NONCODE TRANSCRIPT IDNONHSAT059705.2
NONCODE Gene IDNONHSAG024075.2
Chromosomechr18
Start Site66004312
End Site66005104
Strand-
Exon Number2
CNCI Score-0.0004096
Length295
Assemblyhg38
Other transcript VersionsNONHSAT059705.1(old version)

Sequence


>NONHSAT059705.2
tagacgcaccgcctttaagagctgtgacactcactgcaaaggtctgcagcttcactcctgaagccagtgagaccacgaaccaaccagaaggaagaaactctggacacaacatctttaagaactgtaacactcaccgcgagggtccacagcttcattcttgaagtcagtgagaccaagaaccccccaattccggacacactactacctggctaccacgtatgttcactcaaggtcctagtgctttacaatcggcgggtcacaaagacagccaggagtctttcaccatagctaccgc

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00001.103270.29789300
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000017.4408
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
11.15190010.88860
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
noncodeV3n376071
NONCODEv4NONHSAT059705
noncodeV3Human
lncipedialnc-CDH19-2-1_dup1
PMID26117828TCONS_00017974
PMID26117828PNCT_HSA220561