An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT059719.1

General info


NONCODE TRANSCRIPT IDNONHSAT059719.1
NONCODE Gene IDNONHSAG024081.1
Chromosomechr18
Start Site65173825
End Site65178533
Strand+
Exon Number2
CNCI Score-0.3662650
Length554
Assemblyhg19
Other transcript VersionsNONHSAT059719.2

Sequence


>NONHSAT059719.1
GCTTTTAGCTTTTTATTTTTGTATTAACAGGAGTCTTATTACACATAGGTCTGATAAAACTGGTTTATGATCTTCAGTCTGTTTCCAGTGCTGCATAACTAGATAACGTATGAAGGAAAAACGACGACGAACAAAAAATTAATTGCTTGGAAGACTTAGTTGAATCTATCCATGAAAACAGAATCAATTAAACATGTATGTGTTACTTAGACTAAATATAAATAACCCATATAAATGGTAGCTCAAACATCTCAAGTGTTTCAGAGAATGTTAGAATCTATTGTTTGAAGTGTCTATTGTACTCTATGCAAGTTCTGTTTCCAAACATTAGTATTAGTTGGTGATATTTCCCCTTCATAGGGAAGGTAAAAAAGGTTTGTAGAGGTGGCAAACAATATTTGGTTTAAACTAGCAGGAGACAAAGGAATTCCAAGAAAGGCAAAAATCCTTTCAGTAGTTTTCTGAGGAAAATGCACAATATCTTCAAACTTGACCAGCTGGTAGCTAGTAGGCAGCAAATCTGTATTTATTCTCAAGGCTGCTGCTGTATTTGC

Expression Profile


NA

Exosome Expression Profile(Data Source: NCBI GEO)


NA

Structure Visualization


No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms


Transcript ID
NONHSAT059718.1

Data Sources


Source NameOld Id
PMID26117828TCONS_00017350
ensemblENST00000581951
lncipedialnc-CCDC102B-8-2
gencodeENST00000581951.1
PMID26117828PNCT_HSA054237
NONCODEv4NONHSAT059719