An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT060226.1

General info


NONCODE TRANSCRIPT IDNONHSAT060226.1
NONCODE Gene IDNONHSAG024338.1
Chromosomechr19
Start Site1105583
End Site1105847
Strand+
Exon Number1
CNCI Score-0.0338692
Length264
Assemblyhg19
Other transcript VersionsNONHSAT060226.2

Sequence


>NONHSAT060226.1
CTGGGAGTGTGCAGGGGGCCCGGACTGAGGGGGTGCCAGCCCCCGACTCACTCACACACCTTGGCCGCCACAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAAGTGCGTGACCTCTGGGGACAGTACGGCTGCTGGGGTGGG

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-HMHA1-2-1
NONCODEv4NONHSAT060226
ensemblENST00000587932