An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT061444.2

General info


NONCODE TRANSCRIPT IDNONHSAT061444.2
NONCODE Gene IDNONHSAG024974.2
Chromosomechr19
Start Site14799290
End Site14799762
Strand-
Exon Number1
CNCI Score-0.0696320
Length472
Assemblyhg38
Other transcript VersionsNONHSAT061444.1(old version)

Sequence


>NONHSAT061444.2
CGTCTGTCACCCCCTGCACTATACGGTCATCATGAACCCCCAGCTCTGTGGACTGCTGGTTCTGGGGTCCTGGTGCATCAGTGTCATGGGTTCCCTGCTCGAGACCTTGACTGTTTTGAGGCTGTCCTTCTGCACCGAAATGGAAATTCCACACTTTTTTTGTGATCTACTTGAAGTCCTGAAGCTCGCCTGTTCTGACACCTTCATTAATAACGTGGTGATATACTTTGCAACTGGCGTCCTGGGTGTGATTTCCTTCACTGGAATATTTTTCTCTTACTATAAAATTGTTTTCTCTATACTGAGGATTTCCTCAGCTGGGAGAAAGCACAAAGCGTTTTCCACCTGTGGTTCCCACCTCTCAGTGGTCACCTTGTTCTATGGCACGGGCTTTGGGGTCTATCTCAGTTCTGCAGCCACACCATCTTCTAGGACAAGTCTGGTGGCCTCAGTGATGTACACCATGGTCACC

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
00000000
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
00000000
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
00000.1301991.1750900
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
000030.8932
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
26.28640020.39020
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-EMR2-1-1
NONCODEv4NONHSAT061444
noncodeV3Human
noncodeV3n338334